DNA vaccines against hepatitis C

DNA vaccines against hepatitis C

Two types of plasmids pHCV21 and pcDT, which can be used for DNA immunization, were compared. The first of these contains genes of structural proteins E1 and E2 of the HCV virion. The second-contains an anti-virus genetic program (AGP ). DNA plasmids embedded in the genome of cells are not toxic to them. Cells with pHCV21 form HCV varion proteins, which as an antigen for ELISA allow 85% of cases to confirm the diagnosis. The design principle of pcDT allowed to obtain cells whose fluorescence increases when they are infected with HCV RNA (HCV - sensor). The diagnostic value of HCV - sensor was higher, as fluorescence developed independently of the genotype of infectious HCV RNA. Preparations of DNA plasmids and DNA liposomes are not toxic to rats and mice. With intraperitoneal DNA injection, pHCV21 can probably integrate into the genome of dustus thoracicus nodi lymphaticus cells in rats. In an RNA-infected HCV cell containing pcDT, the AGP sequence enters virus - specific RNA polymerase - dependent replication and is converted into I-RNA for the a-subunit of the diphtheria toxin. The cells killed by the toxin release the total HCV antigen. In this case, the death of cells containing pcDT occurred in the presence of at least 1000 genomes equivalent to infectious RNA, but regardless of its genotype. The obtained result allows us to expect that the lethal effect of AGP on infected cells will not depend on the HCV genotype and will create immunity due to the released total HCV antigen.




Abbreviations adopted


AGP-anti-virus genetic program HCV-hepatitis C virus


DOTAP - 2.3 diaminotrinitrobenzene chloride IgG - immunoglobulin class G


FE - fosfatidiletanolamina ptsl/ts19 - point mutation in the gene ts19

( DNA ) RNA (desoxy ) RNA LD50 -lethal Daza for 50% of experimental animals


(cDNA) RNA - complementary (DNA) RNA HepG2:: pHCV21 - cell line HepG2 with genome-integrated plasmid pHCV21 (pcDT and TGFT, respectively )


mRNA-information RNA 


The enzyme linked immunosorbent assay




The aim of the study was to compare two plasmids that can be immunized against hepatitis C. these were pHCV21 and pcDT. The current beginning of the latter is the AGP. The increase in the number of infected HCV makes it urgent to develop an effective vaccination against this infection. The most promising from this point of view, looks like a DNA vaccine.


          Taking into account the set work, its tasks were:


1 development of a Protocol for obtaining bacterial strains in which the frequency of mutations in HCV cDNA fragments is extremely reduced


2 evaluation of diagnostic value and design or principle of its creation


3 evaluation of the toxicity of drugs plasmid or plasmids containing liposome preparations


4 Comparative evaluation of antiviral activity 




                                materials and methods

  Genetic engineering methods are described in the manual [12]. Manipulations with cultures and animals, transfection with Ca+2-phosphate DNA precipitate, preparation of peroxidase conjugate with anti-HCV IgG and immunodot were performed on [ 6 ] Preparations containing up to 1.5 Gy. DNA was obtained by [12] and purified from chromosomal DNA fragments on the columns. Liposomal (DOTAP: FE = 3 : 7; DNA - lipid Weight ratio = 1: 40 ) were prepared by the method [ 8 ]. RNA transfection was performed according to [ 11] with modifications. Sequencing was performed according to [ 14 ]


                               results and discussions



Transcription of cloned fragments of HCV cDNA in E. coli leads to distortions in the structure of the transcribed matrix [ 1 ]. During the selection of recipients and plasmid vectors with reduced transcription of cloned fragments, it was found that the combination of the defect in phosphoenol-pyruvate; carbohydrate-phosphotransferase system (ptsI/ts19 ) and the presence of the gene element is50 in the genotype of the strain leads to a frequency of point mutations in the cDNA HCV inserts less than 10/ -8 and a complete absence of deletions [ 5 ]


Development of a Protocol for obtaining DNA of plasmids containing unchanged cDNA sequences made it possible to identify variants of HepG2 : : pHCV21 and HepG2: :EGFP , forming either structural virion proteins or "green protein" - EGFP [ 4, 15 ]. In the first case, proteins C, E1 and E2 of HCV genotype 1B were obtained, which were used as antigens for the diagnosis of genotype C by solid-phase ELISA. The effectiveness of the test system with structural proteins HCV was 85% of the"ideal". In the second case, HCV sensor cells were used, which synthesized I-RNA for EFGP and at its 3' and 5' ends there were sequences of HCV genomic RNA [ 13 ]. Infection of HCV - sensor of HCV RNA, even not belonging to genotype 1B [ 13 ] , leads to increased intensity of specific fluorescence. The sensitivity of the HCV sensor was below 1000 gene equivalents of HCV RNA [ 10 ]


                                                                                                                                                                                                                      Table 1




                                                     Comparative characteristics of plasmids






Phcv21 pcDT comparison parameters

Structure 


sequences


Vector-pSV3neo (GenBank acc. No. U02434


insert (from 5'- k 3' -) 2258 p. O. of cDNA genomic 


HCV RNA ( 56 - 2313 BP of GenBank acc. No. AF176573 )


Vector-pSV3neo (GenBank acc. №02434) 


insert ( from 5' - k 3' - ) - 290 p. O. the 5' end to DNA of the genomic RNA of HCV of genotype


1B ( 53 - 342 p. O. from Gen-Bank acc. No. AF176573),


576 p. O. from gene DT ( 240 - 809 BP of GenBank acc. No. I06913 )


107 p. O. 3 ' - end of cDNA of HCV genomic RNA


( 9526 - 9632 p. O. from GenBank acc. 


No. AF176573 )


Expression product structural proteins of Crna varion for dt gene flanked by 5' - k 3' terminal sequences of genomic RNA HCV genotype 1B

Diagnostics


(efficiency and 


sensitivity)


Solid-phase ELISA (85% comparable to other systems ) HCV sensor (no "errors" on 28 samples, > 1000 copies of RNA

The toxicity of preparations of DNA and DNA - liposomes

LD/50 >1.25 mg / g and 


LD/50 > 0.25 mg / g


LD/50 >1.25 mg / g and 


LD/50 > 0.25 mg / g


Morphological changes of internal organs are absent: the amplicon during the PCR on total DNA from ductus thoracicus nodi lymphaticus with primary F : 5'GGCGTTAGTATGAGTGTCGTGCAGC and R: 5'GATTCGTGCTCATGGTGC missing

Anti-virus activity obtained by hyperimmunization of DNA vaccine ( materials [ 7,16] the phenomenon of the DT-A [13] and HCV - dependent cytotoxicity [2 ] with the release of the total HCV - antigen

Plasmid DNA preparations were not toxic to rats and mice with intraperitoneal administration at a dose of 1.25 mg/Gy mass. When morphological control of internal organs showed that the liver, spleen and heart had no signs of inflammation or other pathological processes. Preparations of DNA liposomes in a maximum concentration of 0.25 ml / g of mass also with intraperitoneal administration did not cause death of animals ( rats ). Morphological examination of internal organs also showed no deviations from the control ( animals were injected with 0.15 M NaCL ). In one male rat in total DNA isolated from the material ductus thoracicus nodi lymphaticus ( subfragmatic lymph nodes), PCR revealed sequences of HCV cDNA, characteristic of pHCV21. Probably found a case of integration of pHCV21 in the genome of cells.


In the absence of a developed model of HCV infection on chimpanzees, antiviral activity was tested on HepG2 : : pcDT cells. These cells form RNA AGP (more than 10 copies per cell ) for 2 years without visible toxic effects. When 10/6 cells of AGP carriers were injected with HCV RNA (isolated from the blood of a patient with hepatitis C with severe Virology ( 10/8 genome-equivalents/ml ) , then 10-15 hours after transfection, in the total preparation of cellular RNA by OT-PCR, sequences of I-RNA ( more than one copy per cell) were recorded, programming in the translation of a-subunit of deftirial toxin ( DT-A ). Transfection in the presence of 10µm of ApU diribonucleotide (IA/50= 0.3 nm [ 2] ) - a competitive inhibitor of DT-a - led to a delay in the appearance of I-RNA for DT-a, on average, for 15-20 hours. At a concentration of 20 u/ml interferon and delayed the appearance of I-RNA for DT-a ( 25-40 hours ). In all experiments on the transfection of HCV RNA from HepG2 : : pcDT cells, the accumulation of total HCV antigens during infection was shown. Since the formation of Mature HCV varions in HepG2 cells is not described, the evaluation of the efficacy of AGP as an antiviral drug is yet to come.


           In the literature on DNA immunization, HCV infected chimpanzees, by using plasmids encoding proteins E1 and E2 , asserted the need for hyperimmunisation [7]. The effect can be enhanced by the use of secondary immunization with immunogenic peptide [ 16]. However, there is no evidence of protection against various HCV genotypes.




                                                         summary

Comparison of DNA vaccines prepared on the basis of plasmids pHCV21 or pcDT, which can be made by the authors on the basis of their own and literature data, indicates the ability of pcDT to respond to the genomic RNA HCV of different genotypes. Perhaps this will be immunization against circulating in the body lines of the pathogen.    https://immunoup.com/about_us


             list of references



 1 Gershanovich V. N. / / Molecular genetics, Microbiology and Virology.  - 1998. - T. Z, - P. 8-15


 2 RF Patent № 2158139 " method of selective cell destruction ( options )"


 3 RF Patent No. 2159285 " pcDT Plasmid, method of its application and production"


 4 Sergienko V. I., Martynov, A. K., Sivov I. G. // Immunology. - 1999. - № 9. - P. 54-57


 5 Sivov I. G., Bolshakova E. N.,Romanovskaya G. B., / / V international Congress on immunorehabilitation (Abstracts ). Palma de Mallorca, Spain 1999


 6 Ausubel F. M., Brent R., Kingston R. E., et al // Current protocols in molecular biology.  John Wiley & Sons, Ney-York, Chichester, Toronto, Singapore. One thousand nine hundred ninety six


 7 Bassett S. E. Tomas, D. L., Brasky K. M., Lanford, R. E. // J. Virol. - 1999. V. 73, No. 2. - R . 1118-1126.


 8 Saipo S., Huang L. // Annu. Rev. Biophys / Biomol. Struct, - 2000. V. 29. - P. 27-47


 9 Gurunathan S., Kliman D. M., Seder R. A., // Annu. Rev. Immunoul. - 2000 V. 18. - P. 927-974.


10 Kaneko,S., Murakami, S., Unoura, M., Kobayashi K. // J. Med. Virol. - 1992.- V. 37. - P. 278-282.


11 Kleinschmidt A. M., Pederson T., // Proc. Nath. Acad. Sci. USA. - 1990. - V. 87. - №3-P. 1283-1287.


12 Sambrook k., Fritsch E. F., Maniatis T., / / Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor Lab. Press, Plainview, NY. - 1989.


13 Sergienko V. I., Martynov A. K., Sivov I. G. // International Jurnal of Immunorehabilitation. - 2000. - V. 2. - №3. - P. 24-28.


14 Smith L. M., sanders J. Z., Kaiser r.J., Hughes P., Dodd, C., Connel, C. R., Heiner C., Kent S. B. H. //Nature. -1992.- V.-321 (12 june ). - P. 674-679.


15 Tsien R. Y., / / Annu. Rev. Biochem. - 1998. - V. 67. P. 509-544.


16 Zucchelli S., Capone S., Fattori E., et al // J. Virol. - 2000.- V. 74, - №24. - P. 11598-11607 






* The work was done on the theme of the program " DNA vaccines against hepatitis type C " 


Sivov I. G., Martynov A. K., Sergienko V. I.


Research Institute of physical and chemical medicine Ministry of health of Russia, Moscow




P.S. Materials provided with the consent of the authors


Write a review

Note: HTML is not translated!
    Bad           Good

Popular Articles

How does cooking on a gas stove affect the development of Oncology?

How does cooking on a gas stove affect the development of Oncology?

Most people living in civilized countries of the world cook food with a gas stove.We all used to consider this kind of cooking the most convenient and varied. However, not so long ago, researchers fou..

Principle

Principle

In this article, we describe in General terms the mechanism by which treatment with this drug occurs. In any mammalian body there is a group of cells that is responsible for protecting the body from i..

Turns of fate and cancer

Turns of fate and cancer

         Cancer in the world today occupy the second place in mortality, after cardiovascular. An interesting fact is that neither cardiovascular nor oncological diseases are ..